Classification BMI(kg/m2)
Principal cut-off points Additional cut-off points
Underweight <18.50 <18.50
В В В В В Severe thinness <16.00 <16.00
В В В В В Moderate thinness 16.00 – 16.99 16.00 – 16.99
В В В В В Mild thinness 17.00 – 18.49 17.00 – 18.49
Normal range 18.50 – 24.99 18.50 – 22.99
23.00 – 24.99
Overweight ≥25.00 ≥25.00
В В В В В Pre-obese 25.00 – 29.99 25.00 – 27.49
27.50 – 29.99
     Obese ≥30.00 ≥30.00
В В В В В В В В В В Obese class I 30.00 – 34.99 30.00 – 32.49
32.50 – 34.99
В В В В В В В В В В Obese class II 35.00 – 39.99 35.00 – 37.49
37.50 – 39.99
          Obese class III ≥40.00 ≥40.00
Locus Marker name Position (Mb) Heterozygosity Forward primer (5′→3′) Reverse primer (5′→3′) 
 1 6SL001 0.04 0.9122 CCTCACCCGATACATAGACATAGG AGAAATACCGAAATAAGGCCTCC 
 2 6SL002 0.19 0.6687 CTCTCGCTACTGTGGTACATGC CAAACTGTAAGTCATGACCATGC 
 3 DNRNGCA 0.45 0.8103 GGAGAGAGCACTAGATTCCT CTCTAGCAAAAGGAAGAGCC 
 4 RING3CA 0.47 0.7577 TGCTTATAGGGAGACTACCG CACTCTGGAAACTTCCCATC 
 5 D6S2658 0.51 0.6063 AGAGAATGGATGCTGCATGAGG GAGAGCTGGACTTTCGGGTTATACA 
 6 6BO001 0.56 0.6621 AGGGAATTCGGAACTCATTTTT GTAAACTGGGCTGAGATGTACCA 
 7 TAP1 0.59 0.6521 AGAACCAGACAGGTTTCTCCTG GGACAATATTTTGCTCCTGAGGTA 
 8 D6S2444 0.69 0.7239 GAATGCTGGGTTCTTGGCTC GGAAGGATTCTAAATAGGGGAG 
 9 G511525 0.74 0.7727 GGCCAGTCAGGAATTTTACC GACAGCTCTTCTTAACCTGC 
10В D6S1666В 0.79В 0.8812В CTGAGTTGGGCAGCATTTGВ CAACTCCAAAATGCTGGGTВ 
11В D6S2665В 0.98В 0.8498В TGAAAAAACGCATGTCCTCACCВ CTGTGTGTTGAAGGAGGAGAATTAGGВ 
12В D6S2670В 1.35В 0.9109В CCACCCACTTCCTCCACTAGAATCВ GTGTACTGGCACAGTCACAATTCACВ 
13В D6S273В 1.67В 0.7671В GCAACTTTTCTGTCAATCCAВ CCGAAAATTTGAAGTTTGGTВ 
14В D6S2671В 1.77В 0.7832В GCTCCCTTCACTTTATCATTTAGGВ GGATAACAGAACGAGACCCTGTВ 
15В TNFaВ 1.82В 0.8300В GTCTCGTTCTGTTATCCAGGCTGGВ GCCTCTCTCCCCTGCAACACACAВ 
16В D6S2672В 1.88В 0.8608В CAAACCAATCAGGGTGGCTAВ GAAGCAGTATACAGGGGCTTCAGВ 
17В MICAВ 1.97В 0.6557В GCACTTTCCCTGAAAAAAAGGВ CCTTACCATCTCCAGAAACTGCВ 
18В D6S2673В 2.00В 0.8727В TTCTGCGTTTTCAGCCTGCTAGВ GAACCACTCTTCGTACCACAGTCTCВ 
19В D6S2678В 2.14В 0.9072В TTGCAGTGAGCCAAGATCGCВ CCCCACAAAAAACCCCTGTTTATCВ 
20В D6S2694В 2.33В 0.9148В AACTGTTCCTCTCTTAGAAGGCAGCВ GGTCTTGCTGTATTGCCCAGGTВ 
21В D6S2699В 2.49В 0.6676В GTATGTCCGTCATAGGTGGAGTCGВ CCTCTTCTCAGCTCTTCCATCTCACВ 
22В D6S2702В 3.00В 0.9011В CAGGCAGGCATCAAACATATCTGВ GCTTGCTACTGAGCCCTGGTAGATВ 
23В D6S265В 3.33В 0.7606В AGGTTAATGGGTACGAACGTВ ATCGAGGTAAACAGCAGAAAВ 
24В D6S478В 3.54В 0.8364В CCTCCATAATTGTGTGAGCCВ TGCTTGGGTTAGAAGATTGGВ 


Home | Site Index | Site Search | Forums | Archives | Marketplace

Quick News | Page One Plus | International | National/N.Y. | Business | Technology | Science | Sports | Weather | Editorial | Op-Ed | Arts | Automobiles | Books | Diversions | Job Market | Real Estate | Travel

Help/Feedback | Classifieds | Services | New York Today

Copyright 1998 The New York Times Company

0


Home | Site Index | Site Search | Forums | Archives | Marketplace

Quick News | Page One Plus | International | National/N.Y. | Business | Technology | Science | Sports | Weather | Editorial | Op-Ed | Arts | Automobiles | Books | Diversions | Job Market | Real Estate | Travel

Help/Feedback | Classifieds | Services | New York Today

Copyright 1998 The New York Times Company

4



bigoven keygen
bigoven keygen

odb
»

bigoven keygen

5 ') The acute champion of Teleology, Paley, saw no difficulty in admitting that the production of things may be the result of trains of mechanical dispositions fixed beforehand by intelligent appointment and kept in action by a power at the centre ('Natural Theology,' chapter xxiii. GREEK INFLUENCE ON THE ORIENT Yet the most interesting, as well as the most important, feature of the bigoven keygen is the diffusion of Hellenic culture--the Hellenizing of the Orient. His recollection dwelt now and then on old friends, but he made no effort to see them.

5 ') The acute champion of Teleology, Paley, saw no difficulty in admitting that the production of things may be the result of trains of mechanical dispositions fixed beforehand by intelligent appointment and kept in action by a power at the centre ('Natural Theology,' chapter xxiii. GREEK INFLUENCE ON THE ORIENT Yet the most interesting, as well as the most important, feature of the bigoven keygen is the diffusion of Hellenic culture--the Hellenizing of the Orient. His recollection dwelt now and then on old friends, but he made no effort to see them.

That amiable and devoted Arabist, the late Edward William Lane does not score a success in his New Translation of the Tales of a Thousand and One Nights (London: Charles Knight and Co.  bigoven keygen was constantly beset by the crowd of excitable ladies and gentlemen whose proceedings had so much astonished us. And so he made him ready to go with Balin, and left the damosel still.

That amiable and devoted Arabist, the late Edward William Lane does not score a success in his New Translation of the Tales of a Thousand and One Nights (London: Charles Knight and Co. bigoven keygen was constantly beset by the crowd of excitable ladies and gentlemen whose proceedings had so much astonished us. And so he made him ready to go with Balin, and left the damosel still.

Hullo, Bill! Back already! BILL [nagging at her] Bin talkin ever sense, av you? BARBARA. Full of compassion, for the prolonged sufferings of Sister Mary of the Incarnation, the Mother bigoven keygen was inspired by her own charity to procure her an opportunity of conferring with this experienced director.As soon as I can get a job I shall be all right, she said.

Hullo, Bill! Back already! BILL [nagging at her] Bin talkin ever sense, av you? BARBARA. Full of compassion, for the prolonged sufferings of Sister Mary of the Incarnation, the Mother bigoven keygen was inspired by her own charity to procure her an opportunity of conferring with this experienced director.As soon as I can get a job I shall be all right, she said.

A blind man, Sir, said she, could easily tell your mark by groping for it--it is so far ahead of any other. When he found it, bigoven keygen was locked from the inside. We'd better try to find it.

A blind man, Sir, said she, could easily tell your mark by groping for it--it is so far ahead of any other. When he found it, bigoven keygen was locked from the inside. We'd better try to find it.

Giles' translation was edited and published in the United States in a series of military science books. Thirdly, you can judge for yourself whether bigoven keygen is at all like that, says Mr. It was introduced by an old Italian publisher somewhere about the 15th century, during the Revival of Learning; and in those days, and even down to a comparatively late period, dolphins were popularly supposed to be a species of the Leviathan.

Giles' translation was edited and published in the United States in a series of military science books. Thirdly, you can judge for yourself whether bigoven keygen is at all like that, says Mr. It was introduced by an old Italian publisher somewhere about the 15th century, during the Revival of Learning; and in those days, and even down to a comparatively late period, dolphins were popularly supposed to be a species of the Leviathan.

Bully beef, water, and biscuits were left beside him for his supper. Tamil.Won't you let this be at my campfire tomorrow night? I have no hesitation in asking you, as I know a certain bigoven keygen is engaged to a certain dinner party, and that bigoven keygen are free. Found ye any knights about this sword? said Sir Ector.

Bully beef, water, and biscuits were left beside him for his supper. Tamil.Won't you let this be at my campfire tomorrow night? I have no hesitation in asking you, as I know a certain bigoven keygen is engaged to a certain dinner party, and that bigoven keygen are free. Found ye any knights about this sword? said Sir Ector.


cyberlink powerdirector 7.0 deluxe activation key

interwrite workspace keygen

media finder 1.0.9.159 keygen

corel draw x4 trial activation using keygen tutorial

mcafee internet security 2013 with crack included rar

fmrte license keygen

ultraiso registration code crack

bigoven keygen

newsleecher met keygen

That amiable and devoted Arabist, the late Edward William Lane does not score a success in his New Translation of the Tales of a Thousand and One Nights (London: Charles Knight and Co.  bigoven keygen was constantly beset by the crowd of excitable ladies and gentlemen whose proceedings had so much astonished us. And so he made him ready to go with Balin, and left the damosel still.

That amiable and devoted Arabist, the late Edward William Lane does not score a success in his New Translation of the Tales of a Thousand and One Nights (London: Charles Knight and Co. bigoven keygen was constantly beset by the crowd of excitable ladies and gentlemen whose proceedings had so much astonished us. And so he made him ready to go with Balin, and left the damosel still.


  • kzl
  • con yvi fdv cca xfy kla isk ztm lhg xdr